Evolutionary Dynamics and the Phase Structure of the Minority Game

We show that a simple evolutionary scheme, when applied to the minority game (MG), changes the phase structure of the game. In this scheme each agent evolves individually whenever his wealth reaches the specified bankruptcy level, in contrast to the evolutionary schemes used in the previous works. We show that evolution greatly suppresses herding behavior, and it leads to better overall performance of the agents. Similar to the standard non-evolutionary MG, the dependence of the standard deviation $\sigma$ on the number of agents $N$ and the memory length $m$ can be characterized by a universal curve. We suggest a Crowd-Anticrowd theory for understanding the effect of evolution in the MG.Comment: 4 pages and 3 figure

Cloning a Putative DNA-Binding Protein Controlling the 5\u27LTR of the Copia Element in Drosophila

Copia, a Drosophila retrotransposon, is constitutively expressed in all developmental stages, except the embryo in Drosophila melanogaster. The effect of random integration of the copia element results in phenotypic change in Drosophila. The regulatory sequences, controlling copia expression, are located within the 5\u27LTR. The DNA sequence in the 5\u27LTR and in the location between downstream of entire the 5\u27 LTR and the initial translation site have been identified by mobilityshift binding assays and DNase I footprinting assays. The data reveals three protected regions: a TATA-binding site, the AT-1, and AT-2 binding sites. The TATA-binding site and AT-1 site are located within the 5\u27LTR, while the AT-2 sites is located within the 5\u27UTR of copia element. The sequence protected by the AT-1 protein is ACTATTTATTTATTTATTAGAAAGG, (25\u27bp), located between nucleotides 227 and 252. The AT-1 protein has a candidate region possessing a transactivation domain. No strong similarity in DNA sequence to known DNA-binding motifs was found in the AT-1 sequence. The amino acid sequence of the AT-1 protein, however, carries a high percentage of positively charged amino acids, consistent with a DNA-binding function for the AT-1 protein

Nonlinear Isometries on Schatten- p

Let H be a complex Hilbert space; denote by Alg  and p(H) the atomic nest algebra associated with the atomic nest on H and the space of Schatten-p class operators on, H respectively. Let p(H)∩Alg  be the space of Schatten-p class operators in Alg . When 1≤p<+∞ and p≠2, we give a complete characterization of nonlinear surjective isometries on p(H)∩Alg . If p=2, we also prove that a nonlinear surjective isometry on 2(H)∩Alg  is the translation of an orthogonality preserving map